What does mulberry powder do?

06, Jan. 2025

 

Mulberry leaf powder regulates antioxidative capacity and ...

. Dec 18;7(2):421'429. doi: 10./j.aninu..08.005

Mulberry leaf powder regulates antioxidative capacity and lipid metabolism in finishing pigs

Yingying Liu

Yingying Liu

aCollege of Animal Science and Technology, Hunan Agricultural University, Changsha, , China bKey Laboratory of Agro-ecological Processes in Subtropical Region, Hunan Provincial Engineering Research Center of Healthy Livestock and Poultry, and Scientific Observing and Experimental Station of Animal Nutrition and Feed Science in South-Central, Ministry of Agriculture, Institute of Subtropical Agriculture, Chinese Academy of Sciences, Changsha, , China cHunan Institute of Animal and Veterinary Science, Changsha, , China Find articles by Yingying Liu a,b,c,1, Yinghui Li

Yinghui Li

aCollege of Animal Science and Technology, Hunan Agricultural University, Changsha, , China Find articles by Yinghui Li a,1, Yi Xiao

Yi Xiao

aCollege of Animal Science and Technology, Hunan Agricultural University, Changsha, , China Find articles by Yi Xiao a, Yinglin Peng

Yinglin Peng

cHunan Institute of Animal and Veterinary Science, Changsha, , China Find articles by Yinglin Peng c, Jianhua He

Jianhua He

aCollege of Animal Science and Technology, Hunan Agricultural University, Changsha, , China Find articles by Jianhua He a, Chen Chen

Chen Chen

cHunan Institute of Animal and Veterinary Science, Changsha, , China Find articles by Chen Chen c, Dingfu Xiao

Dingfu Xiao

aCollege of Animal Science and Technology, Hunan Agricultural University, Changsha, , China Find articles by Dingfu Xiao a, Yulong Yin

Yulong Yin

bKey Laboratory of Agro-ecological Processes in Subtropical Region, Hunan Provincial Engineering Research Center of Healthy Livestock and Poultry, and Scientific Observing and Experimental Station of Animal Nutrition and Feed Science in South-Central, Ministry of Agriculture, Institute of Subtropical Agriculture, Chinese Academy of Sciences, Changsha, , China dGuangdong Open Laboratory of Applied Microbiology, Guangdong Institute of Microbiology, Guangdong Academy of Sciences, Guangzhou, , China Find articles by Yulong Yin b,d, Fengna Li

Fengna Li

bKey Laboratory of Agro-ecological Processes in Subtropical Region, Hunan Provincial Engineering Research Center of Healthy Livestock and Poultry, and Scientific Observing and Experimental Station of Animal Nutrition and Feed Science in South-Central, Ministry of Agriculture, Institute of Subtropical Agriculture, Chinese Academy of Sciences, Changsha, , China Find articles by Fengna Li b,'
aCollege of Animal Science and Technology, Hunan Agricultural University, Changsha, , China bKey Laboratory of Agro-ecological Processes in Subtropical Region, Hunan Provincial Engineering Research Center of Healthy Livestock and Poultry, and Scientific Observing and Experimental Station of Animal Nutrition and Feed Science in South-Central, Ministry of Agriculture, Institute of Subtropical Agriculture, Chinese Academy of Sciences, Changsha, , China cHunan Institute of Animal and Veterinary Science, Changsha, , China dGuangdong Open Laboratory of Applied Microbiology, Guangdong Institute of Microbiology, Guangdong Academy of Sciences, Guangzhou, , China

Received Jan 16; Revised Mar 31; Accepted Aug 2; Issue date Jun.

For more information, please visit Yesherb.

© Chinese Association of Animal Science and Veterinary Medicine. Publishing services by Elsevier B.V. on behalf of KeAi Communications Co. Ltd.

This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).

PMCID: PMC  PMID:

Abstract

This study evaluated the potential of mulberry leaf powder as an unconventional feed material for finishing pigs by assessing the growth performance, antioxidative properties, fatty acid profile, and lipid metabolism in 180 Xiangcun black pigs. Pigs with an initial body weight (BW) of 71.64 ± 1.46 kg were randomly assigned to 5 treatment groups, including the control diet and 4 experimental diets. The corn, soybean meal, and wheat bran in the control diet were partly replaced by 3%, 6%, 9%, or 12% mulberry leaf powder in experimental diets. There were 6 replicates (pens) of 6 pigs per replicate in each treatment. Blood and muscle samples were collected after the 50-day feed experiment. Compared with the control group, the 3%, 6%, and 9% mulberry diets had no adverse effect (P > 0.05) on the growth performance of pigs. The serum glutathione peroxidase activity and glutathione concentration increased linearly (P < 0.05) with the increase in dietary mulberry inclusion. There was no significant difference in the relative expression levels of antioxidant-related genes in muscle tissue between the control and mulberry groups. Inclusion of dietary mulberry powder increased (P < 0.05) the content of polyunsaturated fatty acids, especially in the longissimus dorsi (LD) muscle, up-regulated (P < 0.05) the relative mRNA expression level of uncoupling protein-3 in muscle tissue, but down-regulated (P < 0.05) the relative mRNA expression levels of hormone-sensitive lipase, acetyl CoA carboxylase α, lipoprotein lipase, and peroxisome proliferator-activated receptor γ in LD in a linear pattern. The nuclear respiratory factor 2 expression level in the LD muscle of pigs fed the 9% mulberry diet was higher (P < 0.01) than that in the other mulberry groups and control group. The inclusion of less than 12% dietary mulberry did not detrimentally affect the growth performance of Xiangcun black pigs, but enhanced the serum antioxidant property, increased the polyunsaturated fatty acid content, and inhibited lipid oxidation by regulating gene expression levels of lipid metabolism and mitochondrial uncoupling protein in muscle tissue. Mulberry leaves can be utilized as a forage crop in the diet of finishing pigs.

Keywords: Mulberry, Xiangcun black pig, Antioxidative capacity, Fatty acid, Lipid metabolism

1. Introduction

The increasing demand for animal products has led to concomitant demand for sufficient and cheap livestock feed in many developing countries. Feeding strategies, which are based on native feed sources and cost-effective alternatives, have been improved to guarantee the sustainable development of animal husbandry. Many researchers have confirmed that unconventional feed materials can be used to partially replace cereal-based concentrates as livestock feed with no detrimental impact on animal production performance (Li et al., ; Yulistiani et al., ). Unconventional feed materials can have several beneficial functions, among which antimicrobial and antioxidant activities are the most important (Cheong et al., ; Li et al., ).

Mulberry trees (Morus alba L.) are deciduous plants with rapid growth which are planted in many countries. The cultivation area of mulberry in China is estimated to exceed 106 ha (Liu et al., ), and the biomass yield of fresh mulberry leaves is approximately 25 to 30 t/ha per year. Mulberry leaves have been used as feed for silk worms for hundreds of years. Based on their antioxidative, antibacterial, and antihyperlipidemic properties, mulberry leaves are also used in Chinese herbal medicine (Choi et al., ; Wang et al., ; Zou et al., ), e.g., to treat colds, fevers, headaches, coughs, hyperlipemia, diabetes, and rheumatic diseases (Yang et al., ). Furthermore, studies have demonstrated that mulberry leaves can be potential protein sources for cattle (Vu et al., ) and potential supplements of fermentable energy and protein for sheep (Cai et al., ; Yulistiani et al., ). The inclusion of mulberry leaves was shown to reduce the demand for expensive protein feeds in lamb diets (Salinas-Chavira et al., ). In a study of rumen and gastrointestinal digestibility of sheep, it was found that the digestible energy and crude protein values of mulberry leaves were similar to those of alfalfa hay (Doran et al., ).

The major active components of mulberry leaves, such as flavonoids and polyphenols, reportedly possess anti-inflammatory, antioxidant, antidiabetic, hypolipidemic properties, and a neuroprotective function (Chen et al., ; Choi et al., ; Zou et al., ). Mulberry leaves can reportedly be utilized as a new feed supplement to regulate the antioxidant capacity of laying hens (Lin et al., ). However, how mulberry leaf powder influences the antioxidative profile and lipid metabolism in pigs is rarely reported. In this study, we hypothesized that mulberry leaves could be used as a dietary supplement for finishing pigs to improve their antioxidative capacity and regulate their lipid metabolism, to improve animal health. The study objectives were to assess the growth performance, antioxidative capacity, fatty acid profile, and lipid metabolism of Xiangcun black pigs, which were fed various levels of mulberry leaf powder diets.

2. Material and methods

The experiment was conducted in accordance with the Chinese Guidelines for Animal Welfare and Experimental Protocols, and approved by the Animal Care and Use Committee of the Institute of Subtropical Agriculture, Chinese Academy of Sciences.

2.1. Preparation of mulberry leaf powder

After purchased from the Sericultural Research Institute of Hunan Province (Changsha, Hunan, China), green mulberry leaves were dried at 60 °C for 4 d in a heat drier room, where the moisture level was <8%. By using a grinder equipped with a sieve (mesh diameter: 1.5 mm), the dried leaves were crushed into powder, and then stored in a light-proof and well-sealed plastic bag in a 4 °C refrigerator. The nutrient content of mulberry powder was analyzed following the methods of the Association of Official Analytical Chemists (AOAC, ), and determined to be: 23.50% dry matter, 22.66% crude protein (CP), 4.93% ether extract, 12.06% crude fiber, 9.60% crude ash, and 15.27 MJ/kg digestible energy.

2.2. Study animals

A total of 180 Xiangcun black pigs (a Chinese native breed; finishing barrows) obtained from a local commercial farm was used.

2.3. Experimental design

The experimental animals with an average initial body weight (BW) of 71.64 ± 1.46 kg were randomly allocated to 5 treatment groups, including the control diet and 4 experimental diets. The corn, soybean meal, and wheat bran in the control diet were partly replaced by 3%, 6%, 9%, or 12% mulberry leaf powder in the experimental diets. There were 6 replicates (pens) of 6 pigs per replicate in each treatment. All the diets (Table 1) were formulated to meet the recommendations of the Chinese National Feeding Standard of Swine () and contained similar levels of CP. Diets were fed to pigs in pellet form. The animals had ad libitum access to drinking water and feed throughout the experiment. Pigs were fed three times per day at 08:00, 13:00, and 18:00. The trial lasted for 50 d after a 7-d adaptation period. At the beginning and the end of the experiment, pigs were weighed. Feed consumption was recorded daily to determine the average daily gain (ADG), average daily feed intake (ADFI), and the feed intake-to-body gain (F:G) ratio.

Table 1.

Item Mulberry inclusion level, % 0 3 6 9 12 Ingredients  Corn 67.52 66.77 65.65 64.72 63.80  Soybean meal 18.00 17.33 16.50 15.73 14.90  Wheat bran 12.00 10.50 9.60 8.40 7.29  Mulberry powder 0.00 3.00 6.00 9.00 12.00  CaHPO4 0.50 0.60 0.60 0.65 0.66  CaCO3 0.68 0.50 0.35 0.20 0.05  Salt 0.30 0.30 0.30 0.30 0.30  Premix2 1.00 1.00 1.00 1.00 1.00  Total 100.00 100.00 100.00 100.00 100.00 Chemical composition  Digestible energy, MJ/kg 13.72 13.74 13.73 13.73 13.73  Crude protein 14.45 14.47 14.47 14.47 14.45  Crude fiber 2.34 3.01 3.53 4.01 4.34  Total calcium 0.55 0.56 0.55 0.56 0.56  Total phosphorus 0.47 0.48 0.48 0.48 0.48  Available phosphorus 0.20 0.21 0.21 0.22 0.22 Fatty acids composition (% of total fatty acids)  C14:0 0.64 0.57 0.51 0.46 0.41  C16:0 22.12 22.57 22.18 22.19 23.40  C16:1 0.11 0.15 0.11 0.14 0.10  C17:0 0.19 0.20 0.24 0.18 0.25  C18:0 10.06 10.03 9.46 9.16 10.09  C18:1 1.44 1.40 1.37 1.36 1.34  C18:2 60.69 57.32 57.84 58.12 54.40  C18:3 0.20 0.21 0.28 0.16 0.20  C20:0 0.44 0.43 0.52 0.59 0.61  C20:1 4.12 7.12 7.49 7.63 9.18

2.4. Sample collection

At the end of the experimental period, 30 pigs (6 pigs per treatment) were selected for sample collection and slaughter. Blood samples were collected via jugular venipuncture, and centrifuged at 3,000 × g at 4 °C for 15 min to get the supernatants (serum), which was then stored at '20 °C. According to standard commercial procedures, pigs were then electrically stunned, exsanguinated, dehaired, eviscerated, and split down the midline. Muscle tissue samples (about 50 g) of longissimus dorsi muscle (LD) and biceps femoris muscle (BF) from the right side of the carcass were collected within 20 min of slaughter and frozen at '20 °C immediately. Other samples (1.0 cm thick) of LD and BF were quickly frozen in liquid nitrogen and stored at '80 °C.

2.5. Analysis of serum antioxidative parameters

The total antioxidant capacity (T-AOC), contents of glutathione (GSH) and malondialdehyde (MDA), and activities of total superoxide dismutase (T-SOD) and glutathione peroxidase (GPx) in serum were detected according to the manufacturer's instructions of Nanjing Jiancheng commercial kits (Nanjing Jiancheng Bioengineering Institute, Nanjing, Jiangsu, China), by using colorimetric methods with a spectrophotometer (Biomate 5, Thermo Electron Corporation, Rochester, NY).

2.6. Analysis of fatty acid composition

Lipids from the freeze-dried samples of LD and BF (approximately 0.5 g) were extracted in a solution of chloroform and methanol (1:1, vol/vol), and subsequently methylated to fatty acid methyl esters using KOH/methanol (Demirel et al., ). The fatty acid methyl esters were analyzed using an Agilent A gas chromatographer equipped with a SP- column (100 m × 250 μm × 0.2 μm) (Agilent Technologies Inc., Santa Rosa, CA) according to the method described by Liu et al. (). By comparison of their retention times with those of the standards (Sigma Chemical Co., St. Louis, MO), individual fatty acid peaks were identified. Results are expressed as a percentage of the total fatty acids. The contents of saturated fatty acid (SFA), monounsaturated fatty acid (MUFA), and polyunsaturated fatty acid (PUFA), and ratios of PUFA to SFA and Σn-6 to Σn-3 were calculated, as well as the lipid quality indices, i.e., atherogenicity index (AI) and thrombogenicity index (TI), which were evaluated (Σ g/100 g) according to Ulbricht and Southgate ():

AI = (4 × [C14:0] + [C16:0])/(n-6 PUFA + n-3 PUFA + MUFA) TI = ([C14:0] + [C16:0] + [C18:0])/(0.5 × MUFA + 0.5 × n-6 PUFA + 3 × n-3 PUFA + n-3 PUFA/n-6 PUFA)

where the brackets indicate the concentrations.

The hypocholesterolaemic-to-hypercholesterolaemic fatty acids ratio (h:H ratio) was calculated following Fernández et al. ():

h/H = ([C18:1] + [C18:2] + [C18:3] + [C20:3] + [C20:4])/([C14:0] + [C16:0])

where the brackets indicate the concentrations.

2.7. Analysis of quantitative real-time PCR

Total RNA isolation and reverse transcription, cDNA synthesis, and quantitative real-time PCR analysis were performed as described in detail by Liu et al. (). In brief, total RNA was extracted from LD and BF samples (approximately 100 mg) with TRIzol Reagent (Invitrogen-Life Technologies, Carlsbad, CA). By using 1% agarose gel electrophoresis and staining with 10 μg/mL ethidium bromide, RNA was quantified to have an optical density (OD)260-to-OD280 ratio between 1.8 and 2.0. Then, the first-strand cDNA was synthesized according to the manufacturers' instructions. Primers for the selected genes (Table 2) were designed using Primer 5.0 software (Premier Biosoft International, Palo Alto, CA). A real-time PCR was performed using the SYBR Green detection kit (TaKaRa) and the ABI prism HT (Applied Biosystems, USA). The amplification of β-actin in each sample was used to normalize the mRNA levels of the selected genes. We calculated the relative expression ratio (R) of mRNA using R = 2'ΔΔCt (sample-control), where 'ΔΔCt (sample ' control) = (Ct gene of interest ' Ct β-actin) for the sample ' (Ct gene of interest ' Ct β-actin) for the control (Livak and Schmittgen, ).

Table 2.

Gene name Sequence (5''3') Size, bp SOD1 F: GAGACCTGGGCAATGTGACT 189 R: CCAAACGACTTCCAGCATTT GPX1 F: AGCCCAACTTCATGCTCTTC 159 R: CATTGCGACACACTGGAGAC NFE2L2 F: GAAAGCCCAGTCTTCATTGC 190 R: TTGGAACCGTGCTAGTCTCA GCLC F: CAAACCATCCTACCCTTTGG 172 R: ATTGTGCAGAGAGCCTGGTT HSL F: GCAGCATCTTCTTCCGCACA 195 R: AGCCCTTGCGTAGAGTGACA ACCα F: ATCCCTCCTTGCCTCTCCTA 208 R: ACTTCCCGTTCAGATTTCCG LPL F: CTCGTGCTCAGATGCCCTAC 148 R: GGCAGGGTGAAAGGGATGTT PPARγ F: TGACCATGGTTGACACCG 381 R: AAGCATGAACTCCATAGTGG FATP1 F: GGAGTAGAGGGCAAAGCAGG 208 R: AGGTCTGGCGTGGGTCAAAG PGC-1α F: GCCCAGTCTGCGGCTATTT 265 R: GTTCAGCTCGGCTCGGATTT Nrf2 F: GCCCCTGGAAGCGTTAAAC 59 R: GGACTGTATCCCCAGAAGGTTGT UCP2 F: CTTCTGCGGTTCCTCTGTGT 641 R: CATAGGTCACCAGCTCAGCA UCP3 F: GAGATGGTGACCTATGATGT 260 R: CGCAAAAAGGAAGGTGTGAA β-actin F: TGCGGGACATCAAGGAGAAG 216 R: AGTTGAAGGTGGTCTCGTGG

2.8. Statistical analysis

ANOVA of Statistical Packages for Social Science 18.0 (SPSS 18.0) software was used to test the data between the 5 treatment groups, and orthogonal polynomial contrasts were used to evaluate the linear and quadratic effects of increasing dietary mulberry inclusion on the detected traits in the experimental animals. Probability (P) values < 0.05 were considered to be significant, and 0.05 < P < 0.10 were considered to indicate trends.

3. Results

3.1. Growth performance

There was no significant difference in the initial BW (71.38 to 71.96 kg) of experimental pigs among groups. Inclusion of mulberry leaves from 3% to 12% quadratically decreased (P < 0.01) the final BW (98.38 ± 1.66 kg to 93.60 ± 1.58 kg) and ADG (540.00 ± 32 g to 432.80 ± 24 g) of Xiangcun black pigs, but quadratically increased (P < 0.01) the F:G ratio (3.81 to 4.43). No change in the ADFI was observed. Compared with the control group, the 3%, 6%, and 9% mulberry diets had no effect (P > 0.05) on the growth performance of pigs. However, the 12% mulberry diet decreased (P < 0.05) the final BW (93.60 ± 1.58 kg) and ADG (432.80 ± 24 g), and increased (P = 0.05) the F:G ratio (4.43) of Xiangcun black pigs.

3.2. Antioxidative parameters

The concentrations of GSH and MDA, and activities of T-SOD, GPx, and T-AOC in serum of Xiangcun black pigs affected by dietary mulberry inclusion are shown in Table 3. The activity of serum GPx and the concentration of GSH enhanced linearly (P < 0.05) with the increase of dietary mulberry inclusion. The highest values of GPx activity and GSH concentration were observed in the 9% mulberry group and 12% mulberry group, respectively.

Table 3.

Item Mulberry inclusion level, % SEM P-value 0 3 6 9 12 ANOVA Linear Quadratic T-SOD, U/mL 95.04 101.89 98.18 92.19 106.83 4.37 0.17 0.36 0.48 GPx, U/mL 987.48b 979.60b 980.71b 1,042.36a 1,014.80ab 17.19 0.06 0.04 0.12 T-AOC, U/mL 1.49 1.49 1.77 1.33 1.27 0.17 0.30 0.27 0.24 GSH, mg/L 7.55b 10.45ab 10.44ab 11.11ab 13.45a 1.29 0.06 <0.01 0.02 MDA, nmol/mL 3.04 3.93 3.82 3.75 2.99 0.74 0.83 0.86 0.50

The relative mRNA expression levels of the antioxidant-related key genes, superoxide dismutase 1 (SOD1), glutathione peroxidase 1 (GPX1), nuclear factor erythroid 2-like 2 (NFE2L2), and glutamate cysteine ligase catalytic subunit (GCLC) were detected in LD and BF tissues (Table 4), aiming to excavate further the antioxidation function of mulberry diet in skeletal muscle. There was no significant difference in the expression level of antioxidant-related genes between the control group and mulberry groups. The expression level of SOD1 mRNA in LD tissue of pigs fed the 3% mulberry diets was greater (P = 0.09) than in the 6% mulberry diet. The 6% mulberry group had a higher (P = 0.09) expression level of GPX1 mRNA in BF than that of the control group.

Table 4.

Item Mulberry inclusion level, % SEM P-value 0 3 6 9 12 ANOVA Linear Quadratic Longissimus dorsi muscle  SOD1 1.07ab 1.12a 0.78b 0.95ab 0.82ab 0.10 0.09 0.05 0.13  GPX1 1.07 1.29 1.08 1.21 1.48 0.15 0.33 0.13 0.25  NFE2L2 1.03 0.77 0.89 0.98 0.74 0.10 0.21 0.27 0.54  GCLC 1.03 0.93 0.83 0.96 0.81 0.09 0.34 0.13 0.29 Biceps femoris muscle  SOD1 1.05 0.92 1.12 0.81 1.00 0.11 0.32 0.56 0.81  GPX1 1.02b 1.14ab 1.53a 1.22ab 1.32ab 0.10 0.09 0.12 0.11  NFE2L2 1.03 0.79 1.15 0.96 1.03 0.12 0.37 0.71 0.92  GCLC 1.04 0.88 0.92 0.79 0.96 0.12 0.67 0.50 0.45

3.3. Muscular fatty acid profile

A large change was observed in the fatty acid profile of LD and BF tissues in response to the level of dietary mulberry inclusion. As shown in Table 5, the mulberry inclusion level increasing from 0 to 12% linearly decreased (P < 0.05) the concentrations of C16:0 and C16:1 fatty acids, SFA level and indices of AI and TI, and quadratically decreased (P < 0.01) the concentration of C14:0 in LD. Conversely, as the mulberry inclusion increased, the concentrations of C18:2n-6, C18:3n-3, C20:3n-6 and C20:4n-6 fatty acids, PUFA concentration, and ratios of PUFA to SFA and h to H rose linearly (P < 0.05), and the concentration of C17:0 rose quadratically (P < 0.05).

Table 5.

Item Mulberry inclusion level, % SEM P-value 0 3 6 9 12 ANOVA Linear Quadratic Fatty acid composition  C14:0 1.63ab 1.68a 1.59abc 1.51bc 1.43c 0.05 0.02 <0.01 <0.01  C16:0 28.81a 28.44ab 27.84abc 27.00bc 26.38c 0.51 0.01 <0.01 <0.01  C16:1 4.08 4.07 4.01 3.51 3.60 0.19 0.10 0.01 0.05  C17:0 0.20c 0.22bc 0.25abc 0.29a 0.27ab 0.02 0.01 <0.01 <0.01  C18:0 13.98 13.25 13.91 13.67 12.86 0.41 0.27 0.16 0.30  C18:1 41.36 42.4 41.69 42.57 42.92 0.88 0.71 0.23 0.49  C18:2n-6 7.10c 7.35bc 7.89bc 8.51ab 9.23a 0.43 0.01 <0.01 <0.01  C20:0 0.21 0.19 0.20 0.19 0.19 0.01 0.66 0.22 0.44  C20:1 0.96a 0.68ab 0.83ab 0.93a 0.61b 0.10 0.07 0.18 0.39  C18:3n-3 0.51b 0.49b 0.57b 0.90a 0.85a 0.09 <0.01 <0.01 <0.01  C20:3n-6 0.21b 0.22b 0.24ab 0.23b 0.30a 0.02 0.07 0.01 0.03  C20:4n-6 1.21b 1.24b 1.26b 1.14b 1.79a 0.14 0.02 0.04 0.02 Partial sums of fatty acids  SFA 44.83a 43.79a 43.78a 42.66ab 41.13b 0.77 0.02 <0.01 <0.01  MUFA 46.40 47.15 46.53 47.01 47.13 0.83 0.95 0.60 0.87  PUFA 9.03b 9.30b 9.97b 10.78ab 12.17a 0.59 <0.01 <0.01 <0.01  PUFA:SFA ratio 0.20c 0.21bc 0.23bc 0.25ab 0.30a 0.02 <0.01 <0.01 <0.01  'n-6:'n-3 ratio 16.86ab 18.48a 18.02a 11.76b 16.08ab 1.74 0.07 0.16 0.38 Indices  h:H ratio1 1.66c 1.72bc 1.76bc 1.88ab 1.99a 0.06 <0.01 <0.01 <0.01  AI2 0.64a 0.63ab 0.61ab 0.57bc 0.54c 0.02 <0.01 <0.01 <0.01  TI3 1.53a 1.48ab 1.46ab 1.36bc 1.29c 0.05 <0.01 <0.01 <0.01

As shown in Table 6, the increase in dietary mulberry quadratically increased (P < 0.05) the concentration of C17:0 and linearly increased (P < 0.05) the C18:3n-3 concentration, but linearly decreased (P < 0.05) the ratio of 'n-6 to 'n-3 in BF. No obvious difference was detected in the other fatty acids in BF (P > 0.05).

Table 6.

Item Mulberry inclusion level, % SEM P-value 0 3 6 9 12 ANOVA Linear Quadratic Fatty acid composition  C14:0 1.25 1.29 1.54 1.27 1.30 0.09 0.27 0.83 0.39  C16:0 24.05 22.18 24.21 24.09 22.17 0.90 0.30 0.50 0.65  C16:1 3.19 3.00 2.78 3.16 2.96 0.23 0.76 0.70 0.76  C17:0 0.23b 0.30ab 0.39a 0.32ab 0.32ab 0.03 0.05 0.10 0.02  C18:0 11.38 11.14 12.72 11.27 10.99 0.71 0.50 0.75 0.53  C18:1 45.12 44.05 43.13 44.04 42.99 1.38 0.84 0.33 0.60  C18:2n-6 10.62 12.00 11.14 11.37 13.27 0.88 0.31 0.10 0.22  C20:0 0.16 0.18 0.21 0.19 0.18 0.03 0.75 0.64 0.43  C20:1 0.87ab 0.94a 0.65b 0.87ab 0.68b 0.08 0.06 0.09 0.24  C18:3n-3 0.75c 1.11b 0.87bc 1.03bc 1.51a 0.11 <0.01 <0.01 <0.01  C20:3n-6 0.31 0.51 0.35 0.42 0.54 0.07 0.13 0.10 0.26  C20:4n-6 2.44 3.85 2.44 2.49 3.84 0.60 0.24 0.45 0.64 Partial sums of fatty acids1  SFA 37.08 35.09 39.06 37.14 34.97 1.45 0.31 0.61 0.49  MUFA 49.17 48.00 46.57 48.07 46.63 1.48 0.74 0.29 0.53  PUFA 14.12 17.47 14.81 15.31 19.15 1.57 0.14 0.10 0.21  PUFA:SFA ratio 0.39 0.51 0.38 0.43 0.56 0.06 0.16 0.13 0.22  'n-6:'n-3 ratio 18.22a 14.65ab 17.85a 13.89ab 12.21b 1.61 0.05 0.01 0.05 Indices  h:H ratio1 2.35 2.63 2.29 2.43 2.68 0.15 0.27 0.32 0.46  AI2 0.46 0.42 0.5 0.47 0.42 0.03 0.32 0.72 0.50  TI3 1.1 0.98 1.19 1.09 0.94 0.08 0.19 0.43 0.34

Collectively, only the concentrations of C18:0, C18:1, and C20:0 fatty acids in LD were not influenced by mulberry inclusion, while in BF, the concentrations of C14:0, C16:0, C16:1, C18:0, C18:1, C18:2n-6, C20:0, C20:3n-6, and C20:4n-6 fatty acids were similar among groups. The influence of dietary mulberry level on fatty acid traits in LD muscle was greater than in BF muscle.

3.4. Expression levels of lipid metabolism-related genes

We then determined the relative mRNA expression level of the lipid-related genes, hormone-sensitive lipase (HSL), acetyl CoA carboxylase α (ACCα), lipoprotein lipase (LPL), peroxisome proliferator-activated receptor γ (PPARγ), and fatty acid transport protein 1 (FATP1) in skeleton muscle tissues by RT-PCR analysis (Table 7). Dietary mulberry inclusion down-regulated (P < 0.05) the relative mRNA expression levels of HSL, ACCα, LPL, and PPARγ in LD in a linear pattern. Notably, the PPARγ expression level in BF of pigs fed the 12% mulberry diet was greater (P < 0.05) than the other treatment groups. The FATP1 expression levels in BF of the 3%, 6%, and 12% mulberry groups were down-regulated (P < 0.01), compared with that of the 9% mulberry group and the control group.

Table 7.

Item Mulberry inclusion level, % SEM P-value 0 3 6 9 12 ANOVA Linear Quadratic Longissimus dorsi muscle  HSL 1.13a 1.03a 0.77ab 1.05a 0.65b 0.13 0.05 0.03 0.09  ACCα 1.20a 0.87ab 0.65b 0.86ab 0.51b 0.13 <0.01 <0.01 <0.01  LPL 1.09a 0.96ab 0.63b 0.81ab 0.61b 0.14 0.08 0.01 0.04  PPARγ 1.13a 0.84ab 0.63bc 0.78bc 0.44c 0.11 <0.01 <0.01 <0.01  FATP1 1.10 1.04 0.77 0.98 0.78 0.13 0.26 0.09 0.23 Biceps femoris muscle  HSL 1.14 1.03 1.20 1.40 1.32 0.12 0.26 0.07 0.19  ACCα 1.05 0.91 0.93 1.00 1.16 0.15 0.76 0.48 0.38  LPL 1.07 0.72 0.81 0.83 0.91 0.13 0.44 0.65 0.26  PPARγ 1.02b 1.04b 0.98b 0.99b 1.54a 0.15 0.05 0.05 0.02  FATP1 1.54a 0.69b 0.78b 1.42a 0.69b 0.12 <0.01 0.08 0.10

3.5. Expression levels of mitochondrial respiratory-chain related genes

We also determined the mRNA expression levels of mitochondrial respiratory chain related genes, peroxisome proliferator-activated receptor γ coactiva-tor-1α (PGC-1α), nuclear respiratory factor 2 (Nrf2), uncoupling protein-2 (UCP2), and uncoupling protein-3 (UCP3), in LD and BF muscle tissues (Table 8). Dietary mulberry inclusion up-regulated quadratically (P < 0.05) the mRNA expression level of UCP3 in LD. The Nrf2 expression level in LD of the 9% mulberry group was greater (P < 0.01) than those of all the other groups. Similarly, in BF, dietary mulberry inclusion up-regulated (linearly and quadratically, P < 0.05) the mRNA expression level of UCP3. The PGC-1α expression level in BF in the 9% mulberry group was greater (P < 0.01) than that of the other mulberry groups and the control group. The UCP2 expression level in the 6% mulberry group was greater (P < 0.05) than that of the other groups.

Table 8.

Item Mulberry inclusion level, % SEM P-value 0 3 6 9 12 ANOVA Linear Quadratic Longissimus dorsi muscle  PGC-1α 0.85 0.81 0.68 0.85 0.89 0.12 0.80 0.74 0.59  Nrf2 1.53b 1.43bc 1.47bc 1.96a 1.05c 0.15 <0.01 0.44 0.15  UCP2 0.93 0.70 0.91 0.79 1.12 0.11 0.11 0.20 0.08  UCP3 0.99ab 0.80b 0.77b 1.11ab 1.23a 0.13 0.08 0.07 0.03 Biceps femoris muscle  PGC-1α 1.29b 0.85b 1.24b 1.78a 0.91b 0.16 <0.01 0.78 0.63  Nrf2 1.25a 0.53b 0.83b 0.71b 0.62b 0.11 <0.01 0.01 0.01  UCP2 0.99b 0.92b 1.66a 1.18b 1.21b 0.15 0.01 0.20 0.11  UCP3 0.65b 0.54b 0.58b 0.71b 1.39a 0.11 <0.01 <0.01 <0.01

4. Discussion

Morus alba L. (family: Moraceae), commonly known as the white mulberry, is native to China but is currently planted in many countries in the world (Gao et al., ). All the parts of this plant, including the leaves, root bark, stem and fruits, have been used in traditional Chinese medicine (Pel et al., ). Mulberry leaves, specifically, have been used as one of the ingredients in traditional Chinese medicine for the treatment of diabetes (Wilson and Islam, ; Zhang et al., ), atherosclerosis (Chan et al., ; Sugimoto et al., ), and as an immune enhancer because of their antioxidant potential (Bharani et al., ; Yimam et al., ). Previous studies have reported that a moderate content of mulberry leaves in the diet does not detrimentally impact the growth performance of finishing pigs, but improves meat quality by balancing muscle pH, enriching intramuscular fat, and regulating fatty acid profile and glucose metabolic enzyme activities (Li et al., ; Song et al., ). Mulberry leaf powder has been shown to improve nutrient digestibility as well as the development of rumen papillae and stratum basale of fattening Hu sheep (Ouyang et al., ). In the present study, we noted that mulberry leaves did not adversely impact the growth performance of finishing pigs but did positively affect their antioxidant capacity and lipid metabolism.

Oxidative damage occurs when the antioxidant capacity of cells and extracellular space is overwhelmed by exogenous or endogenous reactive oxygen species (ROS). Oxidative damage is a noticeable problem in animal production, because it can affect enzyme activation, signal transduction, and gene expression, and eventually disrupt the redox balance of cells (Shin et al., ). Growing-finishing pigs may easily suffer from oxidative stress due to their rapid growth and oxidative metabolism related to the production of large quantities of free radicals and other active oxygen metabolites. Oxidative stress can compromise the antioxidant status, such as increasing oxidative stress levels and lipid peroxidation, or reducing plasma concentrations of antioxidants. These changes can consequently reduce the health of animals and simultaneously adversely influence productive performance. GPx is part of the enzymatic antioxidant system that can eliminate the peroxides produced during the reactions of molecules with ROS (Liu et al., ). The elevated serum GSH content and GPx activity in the pigs fed mulberry diets in the present study indicated that the antioxidant ability of extracellular enzyme system was increased. Similarly, Lin et al. () reported that the addition of mulberry leaves could enhance the abilities of scavenging free radicals and ROS of laying hens and reducing the MDA concentration to prevent lipid peroxidation. Zeng et al. () also found that a 15% dietary supplement of mulberry leaf reduced the growth performance but increased the T-AOC and GPx, and tended to strengthen the T-SOD activity in serum of finishing pigs.

In the present study, we analyzed the oxidation-related gene expression levels in muscle tissues in an attempt to explain the underlying mechanism. Unexpectedly, however, the results showed no significant difference in the gene mRNA levels related to the oxidative capacity of mulberry diets and the control diet. This result differed from the previous statement, which indicated that the indexes in serum were in accordance with the antioxidant capacity of muscle (Ma et al., ; Zhang et al., ). Such associated mechanisms require further exploration.

Want more information on mulberry extract powder? Feel free to contact us.

Although the high content of PUFA in pork is a satisfactory health characteristic, the influence of PUFA on the oxidative stability, shelf life, and processing of pork is not desirable. Therefore, intramuscular or intermuscular fat and meat quality should be balanced via the use of feed additives or supplements. Jeon () reported that the addition of mulberry leaf silage to beef cattle diets increased the unsaturated fatty acids (USFA) content in the LD muscle of beef cattle. Martínez et al. () also confirmed that the inclusion of mulberry leaves in diets could increase the content of USFA in the muscle, decrease the content of SFA, and especially increase the content of the n-3 and n-6 groups of USFA in meat rabbits. In the present study, extensive changes in fatty acid composition in muscle tissues were observed. It was worth noting that this effect was more obvious in LD muscle than in BF muscle, indicating that mulberry may have slightly different influences on different muscle types. The concentrations of PUFA in LD muscle, such as C18:2n-6, C18:3n-3, C20:3n-6, and C20:4n-6 fatty acids, increased linearly, and ratios of PUFA to SFA and h to H also increased, indicating an improved nutritional value of the meat (Duan et al., ). Moreover, AI and TI are also health indicators. In this study, the low values of AI and TI in LD muscle in pigs fed mulberry leaves indicated that fat composition was 'healthier', which is opposite to the ratio of h to H (Welter et al., ). Collectively, the indices (ratios of PUFA to SFA and h to H, AI, and TI) of meat in pigs fed the mulberry-supplemented diets were more favorable.

Oxidative reactions can activate lipid peroxidation; therefore, reducing oxidative stress can prevent lipid peroxidation (Abdel-Wahhab et al., ). Prior researches have stated that mulberry leaf and its extracts can modify glycometabolism and lipometabolism in other species such as the rat (Wilson and Islam, ) and broilers (Islam et al., ). The bioactive substances in mulberry leaves play important coordinating roles in fat metabolism and deposition. Such compounds include anthocyanin (Chang et al., ), 1-deoxynojirimycin (Tsuduki et al., ), and quercetin derivatives (Sun et al., ), which can inhibit fatty acid synthesis and reduce lipid accumulation in fatty tissues of the liver, kidney, mesentery and epididymis. In vitro testing has also confirmed mulberry leaves to be an excellent source of inhibitory phytochemicals to combat lipid accumulation (Li et al., ). Folium Mori extract has been shown to possess prominent antihyperglycemic and antihyperlipidemic functions by activating the IRS-1/PI3K/Glut-4 signaling pathway in skeletal muscles of type 2 diabetes mellitus rats (Cai et al., ). In the present study, dietary mulberry inclusion down-regulated the mRNA expression levels of adipogenesis genes, such as ACCα, and PPARγ, and lipolysis genes, such as HSL and LPL, in LD in a linear pattern. We propose that the anabolism and catabolism of lipids were suppressed simultaneously in the LD muscle of finishing pigs fed the mulberry leaf diet as a result of the high levels of bioactive compounds contained in the leaves.

As a redox-sensitive transcription factor, Nrf2 interacts with Kelch-like ECH associated protein 1 (Keap 1) in the cytoplasm (McMahon et al., ). When electrophilic insults or ROS signaling are targeting the Nrf2-Keap1 complex, Keap1 separates from Nrf2 (Na and Surh, ). Then, the latter reacts with antioxidant response elements to modulate the expression of downstream antioxidant genes, such as HO-1 and GST, to achieve antioxidant/detoxifying effects. A previous study by Lin et al. () exhibited that dietary supplementation of 0.5% mulberry leaf resulted in significantly greater mRNA levels of antioxidant-related genes, such as HO-1, GST, and Nrf2, which can potentially enhance the production performance and egg quality of laying hens, and in the meantime regulate their antioxidant status. In the current study, the Nrf2 expression level in the LD muscle of the 9% mulberry group was greater than that of the other mulberry groups and the control group. Unlike in the LD muscle, we found that dietary mulberry inclusion linearly down-regulated the mRNA expression level of Nrf2, but up-regulated the mRNA expression level of UCP3 in BF muscle. In recent years, the discovery of uncoupling protein confirmed that mitochondria can reduce the production of ROS by uncoupling. UCP3, an important member of the mitochondrial vector protein family and a candidate gene for obesity, mediates the decoupling of oxidation and phosphorylation of ADP. UCP3 is activated by superoxide and the lipid peroxidation product 4-hydroxy-2-nonenal, thus providing a negative feedback loop for mitochondrial ROS production (Sánchez-Pérez et al., ). Pohl et al. () demonstrated that UCP3 is a specific marker for adult cardiomyocytes, which relies on fatty acid beta-oxidation. Mulberry leaf powder in the present study resulted in a significantly elevated content of PUFA, which could improve beneficial health characteristics of meat, but make it easier to oxidize. The plant additive effectively reduced this process, which was evidenced by a sharp rise in UCP3 mRNA expression level in muscle tissue. Lipids are especially apt to be oxidized; therefore, it can be supposed that inclusion of mulberry leaves protected the USFA from oxidative damage. The components of antioxidant phenols and flavonoids are the main contributing factors of the demonstrated and effective biological activities of mulberry leaves (Gundogdu et al., ). Such leaves can prevent cellular damage and lipid peroxidation by chelating metal ions and scavenging free radicals (Andallu et al., ).

5. Conclusions

The inclusion of mulberry at < 12% in the diet did not impact growth performance but improved oxidative stability in finishing pigs. Mulberry leaf inclusion also affected the expression of genes involved in lipid metabolism and mitochondrial uncoupling in porcine skeletal muscle. These changes can beneficially regulate the pork fatty acid profile and prevent lipid oxidation, which has a positive impact on the health of consumers.

Author contributions

Y. Liu and Y. Li carried out the animal experiments and data analysis, and drafted the manuscript. F. Li and Y. Yin designed the study and revised the manuscript. Y. Xiao helped with the data collection and analysis. C. Chen and D. Xiao participated in the animal trial. J. He and Y. Peng reviewed the manuscript.

Conflict of interest

We declare that we have no financial and personal relationships with other people or organizations that can inappropriately influence our work, there is no professional or other personal interest of any nature or kind in any product, service and/or company that could be construed as influencing the content of this paper.

Acknowledgements

The present work was jointly funded by China Postdoctoral Science Foundation (M), Hunan Provincial Natural Science Foundation of China (JJ), National Natural Science Foundation of China (, ), Key Project of Hunan Provincial Education Department (16A096), and Earmarked Fund for China Agricultural Research System (CARS-35).

Footnotes

Peer review under responsibility of Chinese Association of Animal Science and Veterinary Medicine.

References

  1. Abdel-Wahhab M.A., Abdel-Galil M.M., El-Lithey M. Melatonin counteracts oxidative stress in rats fed an ochratoxin A contaminated diet. J Pineal Res. ;38(2):130'135. doi: 10./j.-079X...x. [DOI] [PubMed] [Google Scholar]
  2. Andallu B., Shankaran M., Ullagaddi R., Iyer S. In vitro free radical scavenging and in vivo antioxidant potential of mulberry (Morus indica L.) leaves. J Herb Med. ;4(1):10'17. [Google Scholar]
  3. Association of Official Analytical Chemists (AOAC) 15th ed. AOAC International; Arlington, VA, USA: . Official Methods of Analysis. [Google Scholar]
  4. Bharani S.E., Asad M., Dhamanigi S.S., Chandrakala G.K. Immunomodulatory activity of methanolic extract of Morus alba Linn. (mulberry) leaves. Pak J Pharm Sci. ;23(1):63'68. [PubMed] [Google Scholar]
  5. Cai M., Mu L., Wang Z.L., Liu J.Y., Liu T.L., Wanapat M., Huang B.Z. Assessment of mulberry leaf as a potential feed supplement for animal feeding in P.R. China. Asian Austral J Anim. ;32(8):'. doi: 10./ajas.18.. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Cai S., Sun W., Fan Y., Guo X., Xu G., Xu T., Hou Y., Zhao B., Feng X., Liu T. Effect of mulberry leaf (Folium Mori) on insulin resistance via IRS-1/PI3K/Glut-4 signalling pathway in type 2 diabetes mellitus rats. Pharm Biol. ;54(11):'. doi: 10./... [DOI] [PubMed] [Google Scholar]
  7. Chan K.C., Yang M.Y., Lin M.C., Lee Y.J., Chang W.C., Wang C.J. Mulberry leaf extract inhibits the development of atherosclerosis in cholesterol-fed rabbits and in cultured aortic vascular smooth muscle cells. J Agric Food Chem. ;61(11):'. doi: 10./jfd. [DOI] [PubMed] [Google Scholar]
  8. Chang J.J., Hsu M.J., Huang H.P., Chung D.J., Chang Y.C., Wang C.J. Mulberry anthocyanins inhibit oleic acid induced lipid accumulation by reduction of lipogenesis and promotion of hepatic lipid clearance. J Agric Food Chem. ;61(25):'. doi: 10./jfk. [DOI] [PubMed] [Google Scholar]
  9. Chen X.Y., Zhang T., Wang X., Hamann M.T., Kang J., Yu D.Q., Chen R.Y. A chemical investigation of the leaves of Morus alba L. Molecules. ;23(5):. doi: 10./molecules. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Cheong S.H., Kim K.H., Jeon B.T., Park P.J., Hwang I.H., Choi N.J., Kim E.T., Hong S.K., Park J.H., Sung S.H., Thomas D.G., Moon S.H. Effect of mulberry silage supplementation during late fattening stage of Hanwoo (Bos taurus coreanae) steer on antioxidative enzyme activity within the longissimus muscle. Anim Prod Sci. ;52:240'247. [Google Scholar]
  11. Choi J., Kang H.J., Kim S.Z., Kwon T.O., Jeong S.I., Jang S.I. Antioxidant effect of astragalin isolated from the leaves of Morus alba L. against free radical-induced oxidative hemolysis of human red blood cells. Arch Pharm Res. ;36(7):912'917. doi: 10./s-013--x. [DOI] [PubMed] [Google Scholar]
  12. Demirel G., Wachira A.M., Sinclair L.A., Wilkinson R.G., Wood J.D., Enser M. Effects of dietary n-3 polyunsaturated fatty acids, breed and dietary vitamin E on the fatty acids of lamb muscle, liver and adipose tissue. Br J Nutr. ;91(4):551'565. doi: 10./BJN. [DOI] [PubMed] [Google Scholar]
  13. Doran M.P., Laca E.A., Sainz R.D. Total tract and rumen digestibility of mulberry foliage (Morus alba), alfalfa hay and oat hay in sheep. Anim Feed Sci Technol. ;138(3'4):239'253. [Google Scholar]
  14. Duan Y., Li F., Li L., Fan J., Sun X., Yin Y. n-6:n-3 PUFA ratio is involved in regulating lipid metabolism and inflammation in pigs. Br J Nutr. ;111(3):445'451. doi: 10./S. [DOI] [PubMed] [Google Scholar]
  15. Fernández M., Ordóñez J.A., Cambero I., Santos C., Pin C., Hoz L.D.L. Fatty acid compositions of selected varieties of Spanish dry ham related to their nutritional implications. Food Chem. ;101(1):107'112. [Google Scholar]
  16. Gao L., Li Y.D., Zhu B.K., Li Z.Y., Huang L.B., Li X.Y., Wang F., Ren F.C., Liao T.G. Two new prenylflavonoids from Morus alba. J Asian Nat Prod Res. ;20(2):117'121. doi: 10./... [DOI] [PubMed] [Google Scholar]
  17. Gundogdu M., Muradoglu F., Sensoy R.I.G., Yilmaz H. Determination of fruit chemical properties of Morus nigra L., Morus alba L. and Morus rubra L. by HPLC. Sci Hortic-Amsterdam. ;132:37'41. [Google Scholar]
  18. Islam M.R., Siddiqui M.N., Khatun A., Siddiky M.N.A., Rahman M.Z., Bostami A.B.M.R., Selim A.S.M. Dietary effect of mulberry leaf (Morus alba) meal on growth performance and serum cholesterol level of broiler chickens. Dissertations & Theses ' Gradworks. ;12(2):79'89. [Google Scholar]
  19. Jeon B.T. Effects of mulberry (Morus alba L) silage supplementation on the haematological traits and meat compositions of Hanwoo (Bos taurus coreanae) steer. Afr J Agric Res. ;7(4) [Google Scholar]
  20. Li H.X., Jo E., Myung C.S., Kim Y.H., Yang S.Y. Lipolytic effect of compounds isolated from leaves of mulberry (Morus alba L.) in 3T3-L1 adipocytes. Nat Prod Res. ;32(16):'. doi: 10./... [DOI] [PubMed] [Google Scholar]
  21. Li Y., Zhang L., Zhong S., Zhang X., Li Q., Lv Z., Ji D. Effects of dietary mulberry leaf on growth performance, fat metabolism and meat quality of finishing pigs. Chinese J Anim Nutr. ;24(9):'. [in Chinese] [Google Scholar]
  22. Li Y.H., Liu Y.Y., Li F.N., Sun A., Lin Q., Huang X.G., Yin Y.L. Effects of dietary ramie powder at various levels on growth performance, antioxidative capacity and fatty acid profile of finishing pigs. J Anim Physiol An N. ;103(2):564'573. doi: 10./jpn.. [DOI] [PubMed] [Google Scholar]
  23. Lin W.C., Lee M.T., Chang S.C., Chang Y.L., Shih C.H., Yu B., Lee T.T. Effects of mulberry leaves on production performance and the potential modulation of antioxidative status in laying hens. Poultry Sci. ;96(5):'. doi: 10./ps/pew350. [DOI] [PubMed] [Google Scholar]
  24. Liu J.X., Yao J., Yan B., Yu J.Q., Shi Z.Q. Effects of mulberry leaves to replace rapeseed meal on performance of sheep feeding on ammoniated rice straw diet. Small Rumin Res. ;39(2):131'136. doi: 10./s-(00)-2. [DOI] [PubMed] [Google Scholar]
  25. Liu W., Zhao C., Wang P., Wang S., Lin H., Qiu L. The response of glutathione peroxidase 1 and glutathione peroxidase 7 under different oxidative stresses in black tiger shrimp, Penaeus monodon. Comp Biochem Physiol B Biochem Mol Biol. ;217:1'13. doi: 10./j.cbpb..12.009. [DOI] [PubMed] [Google Scholar]
  26. Liu Y., Kong X., Li F., Tan B., Li Y., Duan Y., Yin Y., He J., Hu C., Blachier F., Wu G. Co-dependence of genotype and dietary protein intake to affect expression on amino acid/peptide transporters in porcine skeletal muscle. Amino Acids. ;48(1):75'90. doi: 10./s-015--2. [DOI] [PubMed] [Google Scholar]
  27. Liu Y., Li F., He L., Tan B., Deng J., Kong X., Li Y., Geng M., Yin Y., Wu G. Dietary protein intake affects expression of genes for lipid metabolism in porcine skeletal muscle in a genotype-dependent manner. Br J Nutr. ;113(7):'. doi: 10./S. [DOI] [PubMed] [Google Scholar]
  28. Livak K.J., Schmittgen T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. ;25(4):402'408. doi: 10./meth... [DOI] [PubMed] [Google Scholar]
  29. Ma X., Lin Y., Jiang Z., Zheng C., Zhou G., Yu D., Cao T., Wang J., Chen F. Dietary arginine supplementation enhances antioxidative capacity and improves meat quality of finishing pigs. Amino Acids. ;38(1):95'102. doi: 10./s-008--8. [DOI] [PubMed] [Google Scholar]
  30. Martínez M., Motta W., Cervera C., Pla M. Feeding mulberry leaves to fattening rabbits: effects on growth, carcass characteristics and meat quality. Anim Sci. ;80(3):275'281. [Google Scholar]
  31. McMahon M., Thomas N., Itoh K., Yamamoto M., Hayes J.D. Dimerization of substrate adaptors can facilitate cullin-mediated ubiquitylation of proteins by a "tethering" mechanism: a two-site interaction model for the Nrf2-Keap1 complex. J Biol Chem. ;281(34):'. doi: 10./jbc.M. [DOI] [PubMed] [Google Scholar]
  32. Ministry of Agriculture of the People's Republic of China . China Agriculture Press; Beijing, China: . Chinese National Feeding Standard of Swine (GB, NY/T 65') [Google Scholar]
  33. Na H.K., Surh Y.J. Modulation of Nrf2-mediated antioxidant and detoxifying enzyme induction by the green tea polyphenol EGCG. Food Chem Toxicol. ;46(4):'. doi: 10./j.fct..10.006. [DOI] [PubMed] [Google Scholar]
  34. Ouyang J., Wang M., Hou Q., Feng D., Pi Y., Zhao W. Effects of dietary mulberry leaf powder in concentrate on the rumen fermentation and ruminal epithelium in fattening Hu sheep. Animals (Basel) ;9(5):218. doi: 10./ani. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Pel P., Chae H.S., Nhoek P., Kim Y.M., Chin Y.W. Chemical constituents with proprotein convertase subtilisin/kexin type 9 mRNA expression inhibitory activity from dried immature Morus alba fruits. J Agric Food Chem. ;65(26):'. doi: 10./acs.jafc.7b. [DOI] [PubMed] [Google Scholar]
  36. Pohl E.E., Macher G., Hilse K. UCP3: new insights in tissue distribution and (transport) function. Biophys J. ;114(3):44a. [Google Scholar]
  37. Salinas-Chavira J., Castillo-Martinez O., Ramirez-Bribiesca J.E., Mellado M. Effect of increasing levels of white mulberry leaves (Morus alba) on ruminal dry matter degradability in lambs. Trop Anim Health Prod. ;43(5):995'999. doi: 10./s-011--1. [DOI] [PubMed] [Google Scholar]
  38. Sánchez-Pérez P., López-Bernardo E., Anedda A., Cadenas S. Regulation of UCP3 expression and function in response to hypoxia and oxidative stress in mouse cardiomyocytes. Free Radic Biol Med. ;120(suppl-1):s32. [Google Scholar]
  39. Shin J.A., Chung J.S., Cho S.H., Kim H.J., Yoo Y.D. Romo1 expression contributes to oxidative stress-induced death of lung epithelial cells. Biochem Biophys Res Commun. ;439(2):315'320. doi: 10./j.bbrc..07.012. [DOI] [PubMed] [Google Scholar]
  40. Song Q., Wei Q., Zou Z., Zhou Q., Liu L., Chen X., Dong M., Lai Y., Yan J. Effects of mulberry leaf powder on growth performance, meat quality and serum biochemical indexes in finishing pigs. Chinese J Anim Nutr. ;28(2):541'547. [in Chinese] [Google Scholar]
  41. Sugimoto M., Arai H., Tamura Y., Murayama T., Khaengkhan P., Nishio T., Ono K., Ariyasu H., Akamizu T., Ueda Y., Kita T., Harada S., Kamei K., Yokode M. Mulberry leaf ameliorates the expression profile of adipocytokines by inhibiting oxidative stress in white adipose tissue in db/db mice. Atherosclerosis. ;204(2):388'394. doi: 10./j.atherosclerosis..10.021. [DOI] [PubMed] [Google Scholar]
  42. Sun X., Yamasaki M., Katsube T., Shiwaku K. Effects of quercetin derivatives from mulberry leaves: improved gene expression related hepatic lipid and glucose metabolism in short-term high-fat fed mice. Nutr Res Pract. ;9(2):137'143. doi: 10./nrp..9.2.137. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Tsuduki T., Kikuchi I., Kimura T., Nakagawa K., Miyazawa T. Intake of mulberry 1-deoxynojirimycin prevents diet-induced obesity through increases in adiponectin in mice. Food Chem. ;139(1'4):16'23. doi: 10./j.foodchem..02.025. [DOI] [PubMed] [Google Scholar]
  44. Ulbricht T.L., Southgate D.A. Coronary heart disease: seven dietary factors. Lancet. ;338():985'992. doi: 10./-(91)-m. [DOI] [PubMed] [Google Scholar]
  45. Vu C.C., Verstegen M.W.A., Hendriks W.H., Pham K.C. The nutritive value of mulberry leaves (Morus alba) and partial replacement of cotton seed in rations on the performance of growing Vietnamese cattle. Asian Austral J Anim. ;24(9):'. [Google Scholar]
  46. Wang W., Zu Y., Fu Y., Efferth T. In vitro antioxidant and antimicrobial activity of extracts from Morus alba L. leaves, stems and fruits. Am J Chin Med. ;40(2):349'356. doi: 10./SX. [DOI] [PubMed] [Google Scholar]
  47. Welter K.C., Martins C.M., de Palma A.S., Martins M.M., Dos Reis B.R., Schmidt B.L., Saran Netto A. Canola oil in lactating dairy cow diets reduces milk saturated fatty acids and improves its omega-3 and oleic fatty acid content. PloS One. ;11 doi: 10./journal.pone.. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Wilson R.D., Islam M.S. Effects of white mulberry (Morus alba) leaf tea investigated in a type 2 diabetes model of rats. Acta Pol Pharm. ;72(1):153'160. [PubMed] [Google Scholar]
  49. Yang Z.Z., Wang Y.C., Wang Y., Zhang Y.F. Bioassay-guided screening and isolation of alpha-glucosidase and tyrosinase inhibitors from leaves of Morus alba. Food Chem. ;131(2):617'625. [Google Scholar]
  50. Yimam M., Lee Y.C., Kim T.W., Moore B., Jiao P., Hong M., Kim H.J., Nam J.B., Kim M.R., Oh J.S., Cleveland S., Hyun E.J., Chu M., Jia Q. Analgesic and anti-inflammatory effect of UP, a botanical composition containing two standardized extracts of Uncaria gambir and Morus alba. Pharmacogn Res. ;7(Suppl 1):S39'S46. doi: 10./-.. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Yulistiani D., Jelan Z.A., Liang J.B., Yaakub H., Abdullah N. Effects of supplementation of mulberry (Morus alba) foliage and urea-rice bran as fermentable energy and protein sources in sheep fed urea-treated rice straw based diet. Asian-Australas J Anim Sci. ;28(4):494'501. doi: 10./ajas.14.. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Zeng Z., Jiang J.J., Yu J., Mao X.B., Yu B., Chen D. Effect of dietary supplementation with mulberry(Morus alba L.) leaves on the growth performance, meat quality and antioxidative capacity of finishing pigs. J Integr Agr. ;18(1):147'155. [Google Scholar]
  53. Zhang Y., Li F.F., Cao Y.D., He M.L. Supplementation of tea polyphenol mixed with sweetener in diet included with or without flax oil increased antioxidative capacity of blood serum and Longissimus dorsi muscle of fattening pigs. J Anim Sci. ;95(suppl-4):203'204. [Google Scholar]
  54. Zhang Y., Ren C., Lu G., Mu Z., Cui W., Gao H., Wang Y. Anti-diabetic effect of mulberry leaf polysaccharide by inhibiting pancreatic islet cell apoptosis and ameliorating insulin secretory capacity in diabetic rats. Int Immunopharm. ;22(1):248'257. doi: 10./j.intimp..06.039. [DOI] [PubMed] [Google Scholar]
  55. Zou Y., Liao S., Shen W., Liu F., Tang C., Chen C.Y., Sun Y. Phenolics and antioxidant activity of mulberry leaves depend on cultivar and harvest month in Southern China. Int J Mol Sci. ;13(12):'. doi: 10./ijms. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Animal Nutrition are provided here courtesy of KeAi Publishing

Top Benefits of Mulberry Leaf Powder

Mulberry Leaf Powder: A Nutrient-Rich Superfood for Optimal Health

Introduction:

Nature has bestowed upon us a myriad of plants and herbs that possess incredible health-promoting properties. Among these treasures is the mulberry tree, known for its delicious fruits. However, the leaves of the mulberry tree are equally remarkable and have been used for centuries in traditional medicine. Mulberry leaf powder, derived from the leaves of the Morus species, has gained recognition for its exceptional nutritional profile and a multitude of health benefits. In this comprehensive blog, we explore the wonders of mulberry leaf powder and shed light on its remarkable contributions to overall well-being.

What is Mulberry Leaf Powder:

Mulberry leaf powder is a powdered form of the leaves derived from the mulberry tree, scientifically known as the Morus species. Mulberry trees are native to Asia, but they are cultivated in various regions around the world for their nutritious fruits and leaves. While the mulberry fruit is widely known and consumed, the leaves of the tree also possess significant health benefits.

Mulberry leaf powder is created by drying and grinding the leaves into a fine powder, which can then be consumed in various ways. This powder retains the nutritional properties and bioactive compounds found in the leaves, making it a convenient and concentrated form of mulberry leaf extract.

The powder form allows for easy incorporation into various recipes and preparations. It can be added to smoothies, teas, and juices, or used as an ingredient in baked goods, sauces, and soups. Mulberry leaf powder provides a convenient way to access the nutritional and medicinal properties of mulberry leaves, offering a natural and versatile supplement for supporting overall health and well-being.

The Mulberry leaf powder is a good source of the following nutrients:

  • Vitamins: A, C, E, K, and B complex
  • Minerals: Calcium, iron, magnesium, potassium, and zinc
  • Fiber
  • Antioxidants

Benefits of Mulberry Leaf Powder:

  • Rich in Nutrients and Antioxidants:
  • Mulberry leaf powder is a powerhouse of essential nutrients. It is a rich source of vitamins, including vitamin C, vitamin E, and various B vitamins, which are vital for supporting overall health. Additionally, it contains minerals like potassium, calcium, and magnesium, which play crucial roles in maintaining proper bodily functions. Moreover, mulberry leaf powder is loaded with antioxidants, such as flavonoids and anthocyanins, which help protect against oxidative stress and reduce the risk of chronic diseases.

  • Blood Sugar Regulation and Diabetes Management:
  • Mulberry leaf powder has gained attention for its potential in managing blood sugar levels and supporting individuals with diabetes. It contains compounds that inhibit the breakdown of carbohydrates into glucose, thus slowing down the absorption of sugar into the bloodstream. This helps regulate blood sugar levels and may contribute to improved insulin sensitivity. Incorporating mulberry leaf powder into a balanced diet may assist in managing diabetes and reducing the risk of complications associated with the condition.

  • Cholesterol Management and Heart Health:
  • Maintaining healthy cholesterol levels is crucial for cardiovascular well-being. Mulberry leaf powder has demonstrated cholesterol-lowering effects by reducing the absorption of dietary cholesterol and enhancing the breakdown of fats in the liver. This can help manage high cholesterol levels and promote heart health. Moreover, the presence of antioxidants in mulberry leaf powder may contribute to reducing oxidative stress and inflammation, further supporting cardiovascular function.

  • Digestive Health and Weight Management:
  • Mulberry leaf powder possesses properties that support digestive health and aid in weight management. It contains dietary fiber, which helps promote healthy digestion, prevents constipation, and supports regular bowel movements. The fiber content also contributes to a feeling of fullness, reducing overeating and aiding in weight management efforts. Additionally, mulberry leaf powder has been traditionally used to alleviate gastrointestinal issues such as bloating and indigestion.

  • Skin Health and Anti-Aging Benefits:
  • The antioxidants found in mulberry leaf powder play a crucial role in promoting skin health and combating signs of aging. These antioxidants help protect the skin from damage caused by free radicals, environmental pollutants, and UV radiation. Regular consumption or topical application of mulberry leaf powder may contribute to a youthful complexion, improved skin elasticity, and a reduction in the appearance of wrinkles and age spots.

  • Immune System Support:
  • A strong immune system is vital for warding off infections and maintaining optimal health. Mulberry leaf powder contains immune-boosting compounds that help strengthen the body's natural defense mechanisms. The presence of vitamins and antioxidants supports immune function, protects against cellular damage, and aids in preventing illnesses.

    How to use mulberry leaf powder:

    The mulberry powder can be added to a variety of foods and drinks. It can be added to smoothies, yogurt, oatmeal, or cereal. It can also be added to water or juice for a refreshing drink. The mulberry powder can also be used to make tea or baked goods.

    How much mulberry leaf powder should you take?

    The recommended dosage of mulberry powder is 1-2 tablespoons per day. It is important to start with a small dose and increase gradually to see how your body reacts.

    How does mulberry help with feeding silkworms?

    Mulberry leaves are the only food that silkworms can eat. They are a good source of nutrients for silkworms, including protein, carbohydrates, and fiber. Mulberry leaves also contain antioxidants and other beneficial compounds that can help to improve the health of silkworms.

    Silkworms are unable to digest other types of leaves, and they will not grow or develop properly if they are not fed mulberry leaves. Mulberry leaves are also a good source of water, which is important for silkworms.

    Here are some of the ways that mulberry leaves help in feeding silkworms:
    • Provide essential nutrients. Mulberry leaves are a good source of protein, carbohydrates, and fiber, which are all essential nutrients for silkworms. Protein is needed for the growth and development of silkworms, carbohydrates provide energy, and fiber helps to keep the digestive system healthy.
    • Reduce the risk of diseases. Mulberry leaves contain antioxidants and other beneficial compounds that can help to reduce the risk of diseases in silkworms. Antioxidants help to protect cells from damage, which can lead to diseases.
    • Improve the quality of silk. The quality of silk produced by silkworms is affected by the quality of their diet. Silkworms that are fed a diet of mulberry leaves produce silk that is stronger, more lustrous, and more resistant to damage.

    If you are raising silkworms, it is important to provide them with fresh mulberry leaves every day. The leaves should be clean and free of pesticides. You can also provide silkworms with mulberry leaf powder, but it is important to make sure that the powder is fresh and of high quality.

    Conclusion:

    Mulberry leaf powder, with its exceptional nutritional profile and health benefits, offers a natural and holistic approach to promoting well-being. From regulating blood sugar levels and supporting heart health to aiding in digestion, promoting skin health, and boosting the immune system, mulberry leaf powder has proven to be a valuable addition to a healthy lifestyle. Embrace the power of this ancient remedy and experience its transformative effects on your journey to overall vitality and wellness.

    Check this out Medikonda Mulberry Leaf Powder

    If you want to learn more, please visit our website mushroom powder vs mushroom extract.